Mature sequence bta-miR-2285ce

Accession numberMIMAT0046657
IDbta-miR-2285ce
Stem-Loop bta-mir-2285ce
Sequence
gaaaaccugaaugaacuuuuuga
Get sequence
Deep sequencing10648 reads, 77 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).