Mature sequence bta-miR-2285cf

Accession numberMIMAT0046663
IDbta-miR-2285cf
Stem-Loop bta-mir-2285cf
Sequence
caaaguucguucggguuuuuc
Get sequence
Deep sequencing5532 reads, 70 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).