Mature sequence bta-miR-2285ch

Accession numberMIMAT0046671
IDbta-miR-2285ch
Stem-Loop bta-mir-2285ch
Sequence
aucaaugaacuuuuuggccagc
Get sequence
Deep sequencing65 reads, 40 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).