Mature sequence bta-miR-2285ck

Accession numberMIMAT0046676
IDbta-miR-2285ck
Stem-Loop bta-mir-2285ck
Sequence
uggccaaaaucuuuguuucagu
Get sequence
Deep sequencing4 reads, 4 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).