Mature sequence bta-miR-2285cl

Accession numberMIMAT0046681
IDbta-miR-2285cl
Stem-Loop bta-mir-2285cl
Sequence
uaaaguucauucggguuuuu
Get sequence
Deep sequencing101 reads, 23 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).