Mature sequence bta-miR-2285cm

Accession numberMIMAT0046682
IDbta-miR-2285cm
Stem-Loop bta-mir-2285cm
Sequence
aaaaccugaacaaacuuuuugga
Get sequence
Deep sequencing4922 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).