Mature sequence bta-miR-2285cs

Accession numberMIMAT0046693
IDbta-miR-2285cs
Stem-Loop bta-mir-2285cs
Sequence
aaaacccugaaugaacuuuuuga
Get sequence
Deep sequencing4398 reads, 72 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).