Mature sequence bta-miR-2285cu

Accession numberMIMAT0046698
IDbta-miR-2285cu
Stem-Loop bta-mir-2285cu
Sequence
auacccagacgaaccuuuuggc
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).