Mature sequence bta-miR-2285cv

Accession numberMIMAT0046699
IDbta-miR-2285cv
Stem-Loop bta-mir-2285cv-1 bta-mir-2285cv-2
Sequence
gaaaauccaaaugaacuuuuuu
Get sequence
Deep sequencing14 reads, 5 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).