Mature sequence bta-miR-2285cz

Accession numberMIMAT0046706
IDbta-miR-2285cz
Stem-Loop bta-mir-2285cz
Sequence
caaacccgaaugaauuuuuugu
Get sequence
Deep sequencing9 reads, 8 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).