Mature sequence bta-miR-2285da

Accession numberMIMAT0046707
IDbta-miR-2285da
Stem-Loop bta-mir-2285da
Sequence
gaaaaccugaaugaacuuuuuu
Get sequence
Deep sequencing4557 reads, 73 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).