Mature sequence bta-miR-2285db

Accession numberMIMAT0046709
IDbta-miR-2285db
Stem-Loop bta-mir-2285db
Sequence
aaaaguucguucagauuuuucu
Get sequence
Deep sequencing485 reads, 72 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).