Mature sequence dre-miR-24b-5p

Accession numberMIMAT0048662
IDdre-miR-24b-5p
Stem-Loop dre-mir-24b
Sequence
gugccuacugagcugauaacagu
Get sequence
Deep sequencing892 reads, 10 experiments

References

1
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).