Mature sequence mmu-miR-9b-5p

Accession numberMIMAT0049835
IDmmu-miR-9b-5p
Stem-Loop mmu-mir-9b-2 mmu-mir-9b-1 mmu-mir-9b-3
Sequence
uucgguuaucuagcuuuauga
Get sequence
Deep sequencing8374 reads, 22 experiments

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).