Mature sequence mmu-miR-124b-3p

Accession numberMIMAT0049857
IDmmu-miR-124b-3p
Stem-Loop mmu-mir-124b
Sequence
ucaagguccgcugugaacacgg
Get sequence
Deep sequencing160 reads, 28 experiments

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).