Stem-loop sequence cel-mir-36

Accession

MI0000007 (change log)

Description

Caenorhabditis elegans miR-36 stem-loop

Gene family

MIPF0000096; mir-36

Literature search

5 open access papers mention cel-mir-36
(9 sentences)

Stem-loop

   ca    u        a   c  c           ca   c     - au 
5'   ccgc gucgggga ccg gc aauuuucgcuu  gug uagac c  c
     |||| |||||||| ||| || |||||||||||  ||| ||||| |  c
3'   ggcg cagccccu ggu cg uuaaaaguggg  cac aucug g  a
   -a    -        g   a  c           -c   u     u aa 

Deep sequencing

579548 reads, 4.63e+03 reads per million, 17 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrII: 11537713-11537809 [+]
• Overlapping transcripts:

  sense

  Y62F5A.14 ; Y62F5A.14; exon 1

  antisense

  Y62F5A.9 ; Y62F5A.9; intron 2

Clustered miRNAs

< 10kb from cel-mir-36

• cel-mir-35: chrII: 11537608-11537704 [+]
• cel-mir-36: chrII: 11537713-11537809 [+]
• cel-mir-37: chrII: 11537833-11537930 [+]
• cel-mir-38: chrII: 11537933-11538027 [+]
• cel-mir-39: chrII: 11538089-11538175 [+]
• cel-mir-40: chrII: 11538184-11538275 [+]
• cel-mir-41: chrII: 11538308-11538404 [+]

Database links

• RNAcentral:URS0000597516_6239
• miRBase Tracker:MI0000007

Mature sequence cel-miR-36-5p

• Accession: MIMAT0020304
• Previous IDs: cel-miR-36*
• Sequence: 20 - cgccaauuuucgcuucagugcua - 42
• Deep sequencing: 1054 reads, 15 experiments
• Evidence: experimental; Illumina [6]
• Database links:
  • RNAcentral:URS0000031682_6239

Mature sequence cel-miR-36-3p

• Accession: MIMAT0000007
• Previous IDs: cel-miR-36
• Sequence: 61 - ucaccgggugaaaauucgcaug - 82
• Deep sequencing: 578492 reads, 17 experiments
• Evidence: experimental; cloned [1-2], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
• Database links:
  • RNAcentral:URS000055D8AB_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-36
  • microrna.org:cel-miR-36-3p

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
5. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).