Stem-loop sequence cel-mir-37

AccessionMI0000008 (change log)
DescriptionCaenorhabditis elegans miR-37 stem-loop
Gene family MIPF0000096; mir-36
Stem-loop
   uucu       - uu      g  ug     ccgu g     c    uucu 
5'     agaaacc c  ggacca ug  ggugu    u cggug uaca    c
       ||||||| |  |||||| ||  |||||    | ||||| ||||     
3'     ucuuugg g  ccuggu ac  ucaca    g gccac augu    u
   ----       u cu      g  gu     -agu g     u    cuaa 
Get sequence
Deep sequencing
6048172 reads, 6.39e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11537833-11537930 [+]
sense
Y62F5A.14 ; Y62F5A.14; exon 1
antisense
Y62F5A.9 ; Y62F5A.9; intron 2
Clustered miRNAs
< 10kb from cel-mir-37
cel-mir-35chrII: 11537608-11537704 [+]
cel-mir-36chrII: 11537713-11537809 [+]
cel-mir-37chrII: 11537833-11537930 [+]
cel-mir-38chrII: 11537933-11538027 [+]
cel-mir-39chrII: 11538089-11538175 [+]
cel-mir-40chrII: 11538184-11538275 [+]
cel-mir-41chrII: 11538308-11538404 [+]
Database links

Mature sequence cel-miR-37-5p

Accession MIMAT0015094
Previous IDscel-miR-37*
Sequence

22 - 

uguggguguccguugcggugcua

 - 44

Get sequence
Deep sequencing826 reads, 16 experiments
Evidence experimental; CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-37-3p

Accession MIMAT0000008
Previous IDscel-miR-37
Sequence

61 - 

ucaccgggugaacacuugcagu

 - 82

Get sequence
Deep sequencing6047312 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).