Stem-loop sequence cel-mir-38

AccessionMI0000009 (change log)
DescriptionCaenorhabditis elegans miR-38 stem-loop
Gene family MIPF0000096; mir-36
Literature search

2 open access papers mention cel-mir-38
(6 sentences)

Stem-loop
        - -                    uc g        -ac  auc 
5' gugag c cagguccuguuccgguuuuu  c uggugaua   gc   c
   ||||| | ||||||||||||||||||||  | ||||||||   ||    
3' uacuc g guccaggaugaggucaaaaa  g gccacuau   ug   a
        a u                    ga g        cuc  aaa 
Get sequence
Deep sequencing
105027 reads, 659 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11537933-11538027 [+]
antisense
Y62F5A.9 ; Y62F5A.9; intron 2
Clustered miRNAs
< 10kb from cel-mir-38
cel-mir-35chrII: 11537608-11537704 [+]
cel-mir-36chrII: 11537713-11537809 [+]
cel-mir-37chrII: 11537833-11537930 [+]
cel-mir-38chrII: 11537933-11538027 [+]
cel-mir-39chrII: 11538089-11538175 [+]
cel-mir-40chrII: 11538184-11538275 [+]
cel-mir-41chrII: 11538308-11538404 [+]
Database links

Mature sequence cel-miR-38-5p

Accession MIMAT0020305
Previous IDscel-miR-38*
Sequence

17 - 

uccgguuuuuuccguggugaua

 - 38

Get sequence
Deep sequencing264 reads, 13 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-38-3p

Accession MIMAT0000009
Previous IDscel-miR-38
Sequence

58 - 

ucaccgggagaaaaacuggagu

 - 79

Get sequence
Deep sequencing104299 reads, 17 experiments
Evidence experimental; cloned [1-3], Northern [1], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7