Stem-loop sequence cel-mir-39

AccessionMI0000010 (change log)
DescriptionCaenorhabditis elegans miR-39 stem-loop
Gene family MIPF0000304; mir-39
Literature search

4 open access papers mention cel-mir-39
(17 sentences)

Stem-loop
   u     g      c         -  u      a    g    u 
5'  auacc agagcc agcugauuu cg cuuggu auaa cucg c
    ||||| |||||| ||||||||| || |||||| |||| ||||  
3'  ugugg ucucgg ucgacuaaa gu gggcca uauu gagu a
   c     -      u         u  -      c    a    u 
Get sequence
Deep sequencing
2057391 reads, 1.21e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The excised miRNA sequence was initially predicted [1], and confirmed later by sequencing [3].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11538089-11538175 [+]
sense
Y62F5A.15 ; Y62F5A.15; exon 1
antisense
Y62F5A.9 ; Y62F5A.9; intron 2
Clustered miRNAs
< 10kb from cel-mir-39
cel-mir-35chrII: 11537608-11537704 [+]
cel-mir-36chrII: 11537713-11537809 [+]
cel-mir-37chrII: 11537833-11537930 [+]
cel-mir-38chrII: 11537933-11538027 [+]
cel-mir-39chrII: 11538089-11538175 [+]
cel-mir-40chrII: 11538184-11538275 [+]
cel-mir-41chrII: 11538308-11538404 [+]
Database links

Mature sequence cel-miR-39-5p

Accession MIMAT0020306
Previous IDscel-miR-39*
Sequence

15 - 

agcugauuucgucuugguaaua

 - 36

Get sequence
Deep sequencing18769 reads, 17 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-39-3p

Accession MIMAT0000010
Previous IDscel-miR-39
Sequence

55 - 

ucaccggguguaaaucagcuug

 - 76

Get sequence
Deep sequencing2038619 reads, 17 experiments
Evidence experimental; Northern [1], cloned [2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6