Stem-loop sequence cel-mir-49

AccessionMI0000020 (change log)
DescriptionCaenorhabditis elegans miR-49 stem-loop
Gene family MIPF0000237; mir-49
Literature search

3 open access papers mention cel-mir-49
(6 sentences)

Stem-loop
   uuuugaaaaa    a     c       g     au     c  ag aau 
5'           gacc ccguc gcaguuu uugug  gugcu ca  c   c
             |||| ||||| ||||||| |||||  ||||| ||  |    
3'           uugg gguag cgucgaa agcac  cacga gu  g   a
   ---uuuaguc    a     a       g     --     a  cu agu 
Get sequence
Deep sequencing
51177 reads, 418 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 9989282-9989378 [+]
intergenic
Database links

Mature sequence cel-miR-49-5p

Accession MIMAT0020309
Previous IDscel-miR-49*
Sequence

21 - 

cgcaguuuguugugaugugcucc

 - 43

Get sequence
Deep sequencing3089 reads, 15 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-49-3p

Accession MIMAT0000020
Previous IDscel-miR-49
Sequence

61 - 

aagcaccacgagaagcugcaga

 - 82

Get sequence
Deep sequencing48078 reads, 17 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6