Stem-loop sequence cel-mir-54

AccessionMI0000025 (change log)
DescriptionCaenorhabditis elegans miR-54 stem-loop
Gene family MIPF0000874; mir-54
Literature search

1 open access papers mention cel-mir-54
(9 sentences)

Stem-loop
     g   cgc         a    -    -  cg   a a   uug    u 
5' gu agu   gcucugacu ggau auga ga  acg g aca   cuuu u
   || |||   ||||||||| |||| |||| ||  ||| | |||   ||||  
3' ca ucg   cgggacuga ccua uacu cu  ugc c ugu   gaaa u
     g   -au         g    a    u  aa   c a   uca    a 
Get sequence
Deep sequencing
241628 reads, 3.14e+03 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13144996-13145094 [-]
antisense
F09A5.3b ; F09A5.3b; intron 1
Clustered miRNAs
< 10kb from cel-mir-54
cel-mir-54chrX: 13144996-13145094 [-]
cel-mir-55bchrX: 13144830-13144919 [+]
cel-mir-55chrX: 13144827-13144924 [-]
cel-mir-56chrX: 13144691-13144787 [-]
Database links

Mature sequence cel-miR-54-5p

Accession MIMAT0020773
Sequence

19 - 

aggauaugagacgacgagaaca

 - 40

Get sequence
Deep sequencing142657 reads, 17 experiments
Evidence experimental; Illumina [7]
Database links

Mature sequence cel-miR-54-3p

Accession MIMAT0000025
Previous IDscel-miR-54
Sequence

61 - 

uacccguaaucuucauaauccgag

 - 84

Get sequence
Deep sequencing98962 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7