Stem-loop sequence cel-mir-67

AccessionMI0000038 (change log)
DescriptionCaenorhabditis elegans miR-67 stem-loop
Gene family MIPF0000293; mir-67
Literature search

5 open access papers mention cel-mir-67
(14 sentences)

Stem-loop
   gaucaaagauuc       cg   a     -cc      u     auuau 
5'             gucgauc  cuc uucug   gguugu augcu     c
               |||||||  ||| |||||   |||||| |||||      
3'             uagcuag  gag aagau   ccaaca uacga     a
   --uucaaaauuu       au   a     ccu      c     auuag 
Get sequence
Deep sequencing
7028 reads, 688 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 5931349-5931447 [-]
sense
EGAP1.3 ; EGAP1.3; intron 3
antisense
EGAP1.4 ; EGAP1.4; exon 1
Database links

Mature sequence cel-miR-67-5p

Accession MIMAT0020316
Previous IDscel-miR-67*
Sequence

20 - 

cgcucauucugccgguuguuaug

 - 42

Get sequence
Deep sequencing604 reads, 14 experiments
Evidence experimental; Illumina [6]
Database links

Mature sequence cel-miR-67-3p

Accession MIMAT0000039
Previous IDscel-miR-67
Sequence

61 - 

ucacaaccuccuagaaagaguaga

 - 84

Get sequence
Deep sequencing6404 reads, 16 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6