Stem-loop sequence cel-mir-71

AccessionMI0000042 (change log)
DescriptionCaenorhabditis elegans miR-71 stem-loop
Gene family MIPF0000278; mir-71
Literature search

20 open access papers mention cel-mir-71
(324 sentences)

Stem-loop
   ------   -  c   ga   a         u         g   u   a 
5'       guc ug ucu  acg ugaaagaca ggguaguga acg cgg g
         ||| || |||  ||| ||||||||| ||||||||| ||| |||  
3'       cag gc agg  ugc gcuuuuugu cuuaucacu ugc gcu c
   aagguc   u  u   gc   c         -         a   u   c 
Get sequence
Deep sequencing
14364698 reads, 4.47e+04 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 9379927-9380020 [-]
sense
F16A11.3a ; F16A11.3a; intron 5
F16A11.3b ; F16A11.3b; intron 5
F16A11.3c ; F16A11.3c; intron 5
F16A11.3d ; F16A11.3d; intron 8
antisense
F16A11.6 ; F16A11.6; exon 1
Clustered miRNAs
< 10kb from cel-mir-71
cel-mir-71chrI: 9379927-9380020 [-]
cel-mir-2chrI: 9372768-9372865 [-]
Database links

Mature sequence cel-miR-71-5p

Accession MIMAT0000043
Previous IDscel-miR-71
Sequence

16 - 

ugaaagacauggguagugagacg

 - 38

Get sequence
Deep sequencing14361967 reads, 17 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-71-3p

Accession MIMAT0015107
Previous IDscel-miR-71*
Sequence

53 - 

uaucacuauucuguuuuucgc

 - 73

Get sequence
Deep sequencing2722 reads, 16 experiments
Evidence experimental; CLIPseq [6], Illumina [7]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7