Stem-loop sequence cel-mir-72

Accession MI0000043
Description Caenorhabditis elegans miR-72 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop 
      ---      a  ua    ag    u   au      augaucgc 
aggucc   cgucag gc  ggca  augu ggc  agcuga        u
||||||   |||||| ||  ||||  |||| |||  ||||||        a
uccagg   guaguc cg  ccgu  uaca ccg  ucgacu        u
      agu      a  ca    cu    -   cu      aucaacaa
Get sequence
Deep sequencing
24068 reads, 6 experiments
Comments

The expression of C. elegans miR-72 was confirmed by PCR amplification, cloning and sequencing. The predicted hairpin precursor sequence presented here is supported by conservation in C. elegans and C. briggsae (MI0000751 ), and differs from that shown in [1] (Uwe Ohler, pers. comm.). The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [5].

Genome context
Coordinates (WBcel215) Overlapping transcripts
II: 2452843-2452941 [+]
intergenic
Database links

Mature sequence cel-miR-72-5p

Accession MIMAT0000044
Previous IDs cel-miR-72
Sequence

17 -  

aggcaagauguuggcauagcuga

 - 39

Get sequence
Deep sequencing 24020 reads, 6 experiments
Evidence experimental; cloned [1-5], Solexa [6,8], CLIPseq [7]
Validated targets
Predicted targets

Mature sequence cel-miR-72-3p

Accession MIMAT0020318
Previous IDs cel-miR-72*
Sequence

61 -  

agcuucgccacauucugccacg

 - 82

Get sequence
Deep sequencing 48 reads, 6 experiments
Evidence experimental; Solexa [8]
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).
3
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
4
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
5
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
6
PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
7
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
8
PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).