Stem-loop sequence cel-mir-75

AccessionMI0000046 (change log)
DescriptionCaenorhabditis elegans miR-75 stem-loop
Gene family MIPF0000273; mir-75
Literature search

2 open access papers mention cel-mir-75
(10 sentences)

Stem-loop
   uucuugu      -ga   a   c         ca     a    -   au 
5'        ugcuuu   aga uug agucgguug  agcuu aaua caa  c
          ||||||   ||| ||| |||||||||  ||||| |||| |||  c
3'        acgaga   ucu aac ucggccaac  ucgaa uuau guu  g
   ------g      aag   g   u         ca     a    u   aa 
Get sequence
Deep sequencing
54971 reads, 1.86e+03 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 2372453-2372549 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-75
cel-mir-73chrX: 2368765-2368863 [+]
cel-mir-74chrX: 2369043-2369139 [+]
cel-mir-75chrX: 2372453-2372549 [+]
Database links

Mature sequence cel-miR-75-5p

Accession MIMAT0015108
Previous IDscel-miR-75*
Sequence

23 - 

cagucgguugcaagcuuaaaua

 - 44

Get sequence
Deep sequencing2659 reads, 16 experiments
Evidence experimental; CLIPseq [5], Illumina [6]
Database links
Predicted targets

Mature sequence cel-miR-75-3p

Accession MIMAT0000047
Previous IDscel-miR-75
Sequence

61 - 

uuaaagcuaccaaccggcuuca

 - 82

Get sequence
Deep sequencing52308 reads, 16 experiments
Evidence experimental; cloned [1-2], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
4
5
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
6