Stem-loop cel-mir-80

Accession

MI0000051

Description

Caenorhabditis elegans cel-mir-80 precursor miRNA

Gene family

MIPF0000258; mir-80

Literature search

9 open access papers mention cel-mir-80
(304 sentences)

Sequence

610322 reads, 13185 reads per million, 16 experiments

auggacacucguucgcucAGCUUUCGACAUGAUUCUGAACaauccgcaagcccauguuguUGAGAUCAUUAGUUGAAAGCCGAaugaucagagauauc
........(((((((....((((((((((((((.((.((((((............)))))).)))))))..))))))))))))))))...........

Structure

---auggacac       cucA         --     U  G      ccgca 
           ucguucg    GCUUUCGAC  AUGAU CU AACaau     a
           |||||||    |||||||||  ||||| || ||||||      
           aguaAGC    CGAAAGUUG  UACUA GA Uuguug     g
cuauagagacu       ----         AU     -  G      uaccc 

Annotation confidence High

Comments

mir-80 is conserved in C.briggsae (MIR:MI0000518) [1]. Reference [3] reports the identification of miR-227, which appears to be expressed from the 5' arm of the same precursor.

Genome context

chrIII: 8865270-8865367 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from cel-mir-80

Mature cel-miR-80-5p

• Accession: MIMAT0000052
• Description: Caenorhabditis elegans cel-miR-80-5p mature miRNA
• Sequence: 19 - AGCUUUCGACAUGAUUCUGAAC - 40
• Evidence: experimental ; cloned [3], Illumina [6], CLIPseq [7]

Mature cel-miR-80-3p

• Accession: MIMAT0000053
• Description: Caenorhabditis elegans cel-miR-80-3p mature miRNA
• Sequence: 61 - UGAGAUCAUUAGUUGAAAGCCGA - 83
• Evidence: experimental ; cloned [1-4], Northern [1], 454 [5], Illumina [6], CLIPseq [7]

References

1. PubMed ID: 11679671
   An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
   "Lau NC, Lim LP, Weinstein EG, Bartel DP"
   "Science (2001) 294:858-862


2. PubMed ID: 12672692
   The microRNAs of Caenorhabditis elegans
   "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
   "Genes Dev (2003) 17:991-1008


3. PubMed ID: 12747828
   MicroRNAs and other tiny endogenous RNAs in C. elegans
   "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
   "Curr Biol (2003) 13:807-818


4. PubMed ID: 17174894
   Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
   "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
   "Cell (2006) 127:1193-1207


5. PubMed ID: 19460142
   Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
   Kato M, de Lencastre A, Pincus Z, Slack FJ
   Genome Biol (2009) 10:R54


6. PubMed ID: 20062054
   Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
   "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
   "Nat Struct Mol Biol (2010) 17:173-179


7. PubMed ID: 11679672
   An extensive class of small RNAs in Caenorhabditis elegans
   "Lee RC, Ambros V"
   "Science (2001) 294:862-864