Stem-loop sequence cel-mir-86

AccessionMI0000057 (change log)
DescriptionCaenorhabditis elegans miR-86 stem-loop
Gene family MIPF0000247; mir-86
Literature search

9 open access papers mention cel-mir-86
(23 sentences)

Stem-loop
   ---      -c  g   -           g  uu   a   u     a gu 
5'    cguguc  ac ccg ucuaagugaau cu  gcc cag cuucg u  u
      ||||||  || ||| ||||||||||| ||  ||| ||| ||||| |  c
3'    gcacag  ug ggc ggauucgcuua ga  cgg guc gaagu a  u
   acg      uu  a   c           -  cu   -   c     a ag 
Get sequence
Deep sequencing
46441 reads, 950 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 11936637-11936734 [-]
sense
Y56A3A.7a ; Y56A3A.7a; intron 9
Y56A3A.7b ; Y56A3A.7b; intron 11
Clustered miRNAs
< 10kb from cel-mir-86
cel-mir-8211chrIII: 11936916-11936980 [-]
cel-mir-86chrIII: 11936637-11936734 [-]
Database links

Mature sequence cel-miR-86-5p

Accession MIMAT0000059
Previous IDscel-miR-86
Sequence

16 - 

uaagugaaugcuuugccacaguc

 - 38

Get sequence
Deep sequencing32049 reads, 16 experiments
Evidence experimental; cloned [1-3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature sequence cel-miR-86-3p

Accession MIMAT0020776
Sequence

60 - 

cugggcucagauucgcuuaggc

 - 81

Get sequence
Deep sequencing14085 reads, 16 experiments
Evidence experimental; Illumina [7]
Database links

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
3
PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
4
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5
6
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7