miRBase entry: hsa-mir-15a

Stem-loop hsa-mir-15a


Accession
MI0000069
Symbol
HGNC: MIR15A
Description
Homo sapiens hsa-mir-15a precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. hsa-mir-15a, a member of the hsa-mir-15 family, functions as a tumor suppressor by targeting and regulating multiple oncogenes, including BCL2, CCND1, and WNT3 [PMC5814839]. This microRNA has been identified to target a total of 56 genes, with CCND1 being one of the significant genes influenced by its activity [PMC5355656]. The regulatory network involving hsa-mir-15a is extensive and includes other microRNAs such as hsa-miR-16, which targets 63 genes; hsa-miR-155 with 20 target genes including SMAD2; hsa-miR-375 which targets 44 genes such as AKT2 and CDK6; and hsa-miR-429 with 59 target genes including CCND1 [PMC5355656]. Among these microRNAs in the network, hsa-miR-16 is noted for targeting the highest number of genes [PMC5355656].

Literature search
1132 open access papers mention hsa-mir-15a
(3779 sentences)

Sequence

857338 reads, 2648.0 reads per million, 195 experiments
ccuuggaguaaagUAGCAGCACAUAAUGGUUUGUGgauuuugaaaaggugCAGGCCAUAUUGUGCUGCCUCAaaaauacaagg
(((((.......(..((((((((..((((((((((.............))))))))))..))))))))..).......)))))

Structure
     gaguaaa UA        UA          gauuu 
ccuug       g  GCAGCACA  AUGGUUUGUG     u
|||||       |  ||||||||  ||||||||||     g
ggaac       C  CGUCGUGU  UACCGGACgu     a
     auaaaaA UC        UA          ggaaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MIR:MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2].

Genome context
chr13: 50049119-50049201 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-15a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-15a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-15a-5p

Accession MIMAT0000068
Description Homo sapiens hsa-miR-15a-5p mature miRNA
Sequence 14 - UAGCAGCACAUAAUGGUUUGUG - 35
Evidence experimental
cloned [1,3-6], Northern [1]
Database links
Predicted targets

Mature hsa-miR-15a-3p

Accession MIMAT0004488
Description Homo sapiens hsa-miR-15a-3p mature miRNA
Sequence 51 - CAGGCCAUAUUGUGCUGCCUCA - 72
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 12434020
    Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia
    "Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM"
    "Proc Natl Acad Sci U S A (2002) 99:15524-15529