![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-15a |
||||||
Accession | MI0000069 (change log) | |||||
Previous IDs | hsa-mir-15 | |||||
Symbol | HGNC:MIR15A | |||||
Description | Homo sapiens miR-15a stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
![]()
482 open access papers mention hsa-mir-15a | |||||
Stem-loop |
gaguaaa ua ua ga u 5' ccuug g gcagcaca augguuugug uu u ||||| | |||||||| |||||||||| || g 3' ggaac c cgucgugu uaccggacgu aa a auaaaaa uc ua gg a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-15a-5p |
|
Accession | MIMAT0000068 |
Previous IDs | hsa-miR-15a |
Sequence |
14 - uagcagcacauaaugguuugug - 35 |
Deep sequencing | 1119618 reads, 160 experiments |
Evidence | experimental; cloned [1,3-6], Northern [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-15a-3p |
|
Accession | MIMAT0004488 |
Previous IDs | hsa-miR-15a* |
Sequence |
51 - caggccauauugugcugccuca - 72 |
Deep sequencing | 1503 reads, 107 experiments |
Evidence | experimental; cloned [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 |
PMID:12434020
"Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia"
Proc Natl Acad Sci U S A. 99:15524-15529(2002).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
6 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|