Stem-loop sequence hsa-mir-15a

Accession

MI0000069 (change log)

Previous IDs

hsa-mir-15

Symbol

HGNC:MIR15A

Description

Homo sapiens miR-15a stem-loop

Gene family

MIPF0000006; mir-15

Literature search

482 open access papers mention hsa-mir-15a
(1766 sentences)

Stem-loop

        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 

Deep sequencing

1121155 reads, 4.04e+03 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr13: 50049119-50049201 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000044927 ; SETDB2-003; intron 5

  OTTHUMT00000044925 ; SETDB2-001; intron 6

  ENST00000258672 ; SETDB2-003; intron 5

  ENST00000354234 ; SETDB2-201; intron 5

  ENST00000317257 ; SETDB2-001; intron 6

Clustered miRNAs

< 10kb from hsa-mir-15a

• hsa-mir-15a: chr13: 50049119-50049201 [-]
• hsa-mir-16-1: chr13: 50048973-50049061 [-]

Database links

• EntrezGene:MIR15A
• HGNC:MIR15A
• RNAcentral:URS0000171CD1_9606
• miRBase Tracker:MI0000069

Mature sequence hsa-miR-15a-5p

• Accession: MIMAT0000068
• Previous IDs: hsa-miR-15a
• Sequence: 14 - uagcagcacauaaugguuugug - 35
• Deep sequencing: 1119618 reads, 160 experiments
• Evidence: experimental; cloned [1,3-6], Northern [1]
• Database links:
  • RNAcentral:URS00003D1AE3_9606
• Predicted targets:
  • TargetMiner:hsa-miR-15a-5p
  • TargetScanVert:hsa-miR-15a-5p
  • miRDB:hsa-miR-15a-5p
  • microrna.org:hsa-miR-15a-5p

Mature sequence hsa-miR-15a-3p

• Accession: MIMAT0004488
• Previous IDs: hsa-miR-15a*
• Sequence: 51 - caggccauauugugcugccuca - 72
• Deep sequencing: 1503 reads, 107 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS00001C94E0_9606
• Predicted targets:
  • TargetMiner:hsa-miR-15a-3p
  • TargetScanVert:hsa-miR-15a-3p
  • miRDB:hsa-miR-15a-3p
  • microrna.org:hsa-miR-15a-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12434020 "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia" Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM Proc Natl Acad Sci U S A. 99:15524-15529(2002).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).