Stem-loop sequence hsa-mir-15a

AccessionMI0000069 (change log)
Previous IDshsa-mir-15
Symbol HGNC:MIR15A
DescriptionHomo sapiens miR-15a stem-loop
Gene family MIPF0000006; mir-15
Literature search

482 open access papers mention hsa-mir-15a
(1766 sentences)

Stem-loop
        gaguaaa ua        ua          ga  u 
5' ccuug       g  gcagcaca  augguuugug  uu u
   |||||       |  ||||||||  ||||||||||  || g
3' ggaac       c  cgucgugu  uaccggacgu  aa a
        auaaaaa uc        ua          gg  a 
Get sequence
Deep sequencing
1121155 reads, 4.04e+03 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Reference [1] named this sequence miR-15. This is renamed miR-15a here to avoid confusion with miR-15b (MI0000438) identified later by others. This gene and miR-16 are clustered within 0.5 kb at 13q14. This region has been shown to be deleted in more than half of B cell chronic lymphocytic leukemias (CLL). Both miR-15a and miR-16 are deleted or down-regulated in more than two thirds of CLL cases [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr13: 50049119-50049201 [-]
antisense
OTTHUMT00000044927 ; SETDB2-003; intron 5
OTTHUMT00000044925 ; SETDB2-001; intron 6
ENST00000258672 ; SETDB2-003; intron 5
ENST00000354234 ; SETDB2-201; intron 5
ENST00000317257 ; SETDB2-001; intron 6
Clustered miRNAs
< 10kb from hsa-mir-15a
hsa-mir-15achr13: 50049119-50049201 [-]
hsa-mir-16-1chr13: 50048973-50049061 [-]
Database links

Mature sequence hsa-miR-15a-5p

Accession MIMAT0000068
Previous IDshsa-miR-15a
Sequence

14 - 

uagcagcacauaaugguuugug

 - 35

Get sequence
Deep sequencing1119618 reads, 160 experiments
Evidence experimental; cloned [1,3-6], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-15a-3p

Accession MIMAT0004488
Previous IDshsa-miR-15a*
Sequence

51 - 

caggccauauugugcugccuca

 - 72

Get sequence
Deep sequencing1503 reads, 107 experiments
Evidence experimental; cloned [5]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:12434020 "Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia" Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM Proc Natl Acad Sci U S A. 99:15524-15529(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).