Stem-loop sequence hsa-mir-19a

Accession MI0000073
Symbol HGNC:MIR19A
Description Homo sapiens miR-19a stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There maybe 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    u  u                 --      ---    ag 
gcag cc cuguuaguuuugcauag  uugcac   uaca  a
|||| || |||||||||||||||||  ||||||   ||||  a
cguc gg gguagucaaaacguauc  aacgug   augu  g
    c  u                 ua      uug    aa 
Get sequence
Deep sequencing
9759 reads, 35 experiments
Comments

This sequence maps to chromosome 13 and is named miR-19a precursor-13 in reference [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr13: 92003145-92003226 [+]
sense
OTTHUMT00000442497 ; MIR17HG-002; exon 2
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000045448 ; MIR17HG-001; intron 3
OTTHUMT00000442498 ; MIR17HG-003; exon 3
ENST00000582141 ; MIR17HG-002; exon 2
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000400282 ; MIR17HG-001; intron 3
ENST00000581816 ; MIR17HG-003; exon 3
Clustered miRNAs
< 10kb from hsa-mir-19a
hsa-mir-17 chr13: 92002859-92002942 [+]
hsa-mir-18a chr13: 92003005-92003075 [+]
hsa-mir-19a chr13: 92003145-92003226 [+]
hsa-mir-20a chr13: 92003319-92003389 [+]
hsa-mir-19b-1 chr13: 92003446-92003532 [+]
hsa-mir-92a-1 chr13: 92003568-92003645 [+]
Database links

Mature sequence hsa-miR-19a-5p

Accession MIMAT0004490
Previous IDs hsa-miR-19a*
Sequence

14 - 

aguuuugcauaguugcacuaca

 - 35

Get sequence
Deep sequencing 8 reads, 4 experiments
Evidence experimental; cloned [4]
Predicted targets

Mature sequence hsa-miR-19a-3p

Accession MIMAT0000073
Previous IDs hsa-miR-19a
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Deep sequencing 9751 reads, 34 experiments
Evidence experimental; cloned [1-5], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).