Stem-loop sequence hsa-mir-20a

Accession

MI0000076 (change log)

Previous IDs

hsa-mir-20

Symbol

HGNC:MIR20A

Description

Homo sapiens miR-20a stem-loop

Gene family

MIPF0000001; mir-17

Literature search

463 open access papers mention hsa-mir-20a
(1933 sentences)

Stem-loop

       c   -a                 g   -  uu 
5' guag acu  aagugcuuauagugcag uag ug  u
   |||| |||  ||||||||||||||||| ||| ||   
3' cguc uga  uucacgaguauuacguc auc au  a
       a   aa                 -   u  ug 

Deep sequencing

1953373 reads, 7.48e+03 reads per million, 157 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr13: 91351065-91351135 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-20a

• hsa-mir-17: chr13: 91350605-91350688 [+]
• hsa-mir-18a: chr13: 91350751-91350821 [+]
• hsa-mir-19a: chr13: 91350891-91350972 [+]
• hsa-mir-20a: chr13: 91351065-91351135 [+]
• hsa-mir-19b-1: chr13: 91351192-91351278 [+]
• hsa-mir-92a-1: chr13: 91351314-91351391 [+]

Database links

• EntrezGene:MIR20A
• HGNC:MIR20A
• RNAcentral:URS0000507C9B_9606
• miRBase Tracker:MI0000076

Mature sequence hsa-miR-20a-5p

• Accession: MIMAT0000075
• Previous IDs: hsa-miR-20;hsa-miR-20a
• Sequence: 8 - uaaagugcuuauagugcagguag - 30
• Deep sequencing: 1925290 reads, 156 experiments
• Evidence: experimental; cloned [1,4-7], Northern [1]
• Database links:
  • RNAcentral:URS0000574A2C_9606
• Predicted targets:
  • TargetMiner:hsa-miR-20a-5p
  • TargetScanVert:hsa-miR-20a-5p
  • miRDB:hsa-miR-20a-5p
  • microrna.org:hsa-miR-20a-5p

Mature sequence hsa-miR-20a-3p

• Accession: MIMAT0004493
• Previous IDs: hsa-miR-20a*
• Sequence: 44 - acugcauuaugagcacuuaaag - 65
• Deep sequencing: 28082 reads, 154 experiments
• Evidence: experimental; cloned [6]
• Database links:
  • RNAcentral:URS0000042E1F_9606
• Predicted targets:
  • TargetMiner:hsa-miR-20a-3p
  • TargetScanVert:hsa-miR-20a-3p
  • miRDB:hsa-miR-20a-3p
  • microrna.org:hsa-miR-20a-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
5. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).