MIR20A is a microRNA that has been implicated in various cellular processes, including the regulation of apoptosis proteins and the modulation of cellular proliferation and migration in the context of cancer [PMC6912041]. Research has shown that atelocollagen-based gene-activated matrices (GAM) containing plasmid DNAs encoding MIR20A (pMIR20A) can be used to enhance cranial bone augmentation in rats, a model relevant to regenerative therapy for jawbone atrophy [PMC7955717]. The expression levels of MIR20A, along with other microRNAs, can be quantified using RT-PCR techniques to assess their relative abundance in different experimental groups [PMC9687337]. Interestingly, the upregulation of SNHG5 has been found to decrease MIR20A levels, which subsequently leads to an increase in apoptosis-related proteins such as BECN1, ATG5, and ATG7 and affects the autophagic process as indicated by LC3‐II/LC3‐I ratios [PMC6912041]. Preliminary experiments have also indicated that atelocollagen-based delivery systems for MIR20A are highly efficient and non-toxic for transfection into cultured mesenchymal stem cells (MSCs), offering an advantage over traditional commercial vectors like lentiviral vectors [PMC7955717].
c -A G uguu guag acU AAGUGCUUAUAGUGCAG UAG u |||| ||| ||||||||||||||||| ||| a cguc uGA UUCACGAGUAUUACGUC Auc g a AA - uauu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000075 |
Description | Homo sapiens hsa-miR-20a-5p mature miRNA |
Sequence | 8 - UAAAGUGCUUAUAGUGCAGGUAG - 30 |
Evidence |
experimental
cloned [1,4-7], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004493 |
Description | Homo sapiens hsa-miR-20a-3p mature miRNA |
Sequence | 44 - ACUGCAUUAUGAGCACUUAAAG - 65 |
Evidence |
experimental
cloned [6] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|