miRBase entry: hsa-mir-22

Stem-loop hsa-mir-22


Accession
MI0000078
Symbol
HGNC: MIR22
Description
Homo sapiens hsa-mir-22 precursor miRNA mir-22
Gene
family?
RF00653; mir-22

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR22 is a microRNA implicated in various cellular processes, including the inflammatory response to viral infections [PMC7530758]. Research involving the knockdown of RPL29 in U251 and EA.hy926 cells, followed by poly(I:C) treatment, has been conducted to elucidate the role of MIR22, with findings suggesting a regulatory function of MIR22 in response to viral-induced inflammation [PMC7530758]. Specifically, changes in MIR22 expression have been observed to influence inflammation in the context of transmissible gastroenteritis virus infection in porcine epithelial cells [PMC7530758]. Additionally, studies have indicated that low expression levels of MIR22 are associated with certain outcomes, as evidenced by survival analysis [PMC9284388]. However, the precise mechanisms by which RPL29 regulates MIR22 and the subsequent pathways involved require further investigation to be fully understood [PMC7530758].

Literature search
902 open access papers mention hsa-mir-22
(3411 sentences)

Sequence

2425044 reads, 6073.0 reads per million, 194 experiments
ggcugagccgcaguAGUUCUUCAGUGGCAAGCUUUAuguccugacccagcuaAAGCUGCCAGUUGAAGAACUGUugcccucugcc
(((.(((..((((((((((((((((((((.((((((.((.........))))))))))))).))))))))))))))).))).)))

Structure
   u   cc               -     A      u  ccu 
ggc gag  gcaguAGUUCUUCAG UGGCA GCUUUA gu   g
||| |||  ||||||||||||||| ||||| |||||| ||   a
ccg cuc  cguUGUCAAGAAGUU ACCGU CGAAau cg   c
   u   -c               G     -      -  acc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 1713903-1713987 [-]

Disease association
hsa-mir-22 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-22 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-22 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-22-5p

Accession MIMAT0004495
Description Homo sapiens hsa-miR-22-5p mature miRNA
Sequence 15 - AGUUCUUCAGUGGCAAGCUUUA - 36
Evidence experimental
cloned [4]
Database links
Predicted targets

Mature hsa-miR-22-3p

Accession MIMAT0000077
Description Homo sapiens hsa-miR-22-3p mature miRNA
Sequence 53 - AAGCUGCCAGUUGAAGAACUGU - 74
Evidence experimental
cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  6. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854