WARNING: This summary was generated by AI. MIR22 is a microRNA implicated in various cellular processes, including the inflammatory response to viral infections [PMC7530758]. Research involving the knockdown of RPL29 in U251 and EA.hy926 cells, followed by poly(I:C) treatment, has been conducted to elucidate the role of MIR22, with findings suggesting a regulatory function of MIR22 in response to viral-induced inflammation [PMC7530758]. Specifically, changes in MIR22 expression have been observed to influence inflammation in the context of transmissible gastroenteritis virus infection in porcine epithelial cells [PMC7530758]. Additionally, studies have indicated that low expression levels of MIR22 are associated with certain outcomes, as evidenced by survival analysis [PMC9284388]. However, the precise mechanisms by which RPL29 regulates MIR22 and the subsequent pathways involved require further investigation to be fully understood [PMC7530758].
u cc - A u ccu ggc gag gcaguAGUUCUUCAG UGGCA GCUUUA gu g ||| ||| ||||||||||||||| ||||| |||||| || a ccg cuc cguUGUCAAGAAGUU ACCGU CGAAau cg c u -c G - - acc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004495 |
| Description | Homo sapiens hsa-miR-22-5p mature miRNA |
| Sequence | 15 - AGUUCUUCAGUGGCAAGCUUUA - 36 |
| Evidence |
experimental
cloned [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000077 |
| Description | Homo sapiens hsa-miR-22-3p mature miRNA |
| Sequence | 53 - AAGCUGCCAGUUGAAGAACUGU - 74 |
| Evidence |
experimental
cloned [1,3-5], Northern [1], Illumina [6] |
| Database links |
|
| Predicted targets |
|
|