Stem-loop sequence hsa-mir-23a

Accession

MI0000079

Previous IDs

hsa-mir-23

Symbol

HGNC:MIR23A

Description

Homo sapiens miR-23a stem-loop

Gene family

MIPF0000027; mir-23

Stem-loop

  c   c     -       g    g      cuuc 
gg cgg ugggg uuccugg gaug gauuug    c
|| ||| ||||| ||||||| |||| ||||||     
cc gcc accuu agggacc uuac cuaaac    u
  a   a     u       g    a      acug 

Deep sequencing

89471 reads, 54 experiments

Comments

This miRNA was previously named miR-23 [1,2] but is renamed here to avoid confusion with the more recently described miR-23b (MI0000439 ). Kawasaki and Taira reported that miR-23 regulates the transcriptional repressor Hairy enhancer of split (HES1) [3]. This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.

Genome context

• Coordinates (GRCh37.p5): chr19: 13947401-13947473 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-23a

• hsa-mir-23a: chr19: 13947401-13947473 [-]
• hsa-mir-27a: chr19: 13947254-13947331 [-]
• hsa-mir-24-2: chr19: 13947101-13947173 [-]

Database links

• EMBL: AF480526;AF480526
• EMBL: AF480558;AF480558
• EMBL: AJ421743;HSA421743
• ENTREZGENE: 407010;MIR23A
• HGNC: 31605;MIR23A

Mature sequence hsa-miR-23a-5p

• Accession: MIMAT0004496
• Previous IDs: hsa-miR-23a*
• Sequence: 9 - gggguuccuggggaugggauuu - 30
• Deep sequencing: 327 reads, 17 experiments
• Evidence: experimental; cloned [6-7]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-23a-5p
  • MICRORNA.ORG:hsa-miR-23a-5p
  • MIRDB:hsa-miR-23a-5p
  • RNA22-HSA:hsa-miR-23a-5p
  • TARGETMINER:hsa-miR-23a-5p
  • PICTAR-VERT:hsa-miR-23a

Mature sequence hsa-miR-23a-3p

• Accession: MIMAT0000078
• Previous IDs: hsa-miR-23a
• Sequence: 45 - aucacauugccagggauuucc - 65
• Deep sequencing: 89144 reads, 51 experiments
• Evidence: experimental; cloned [1,4-7], Northern [1]
• Validated targets:
  • TARBASE:hsa-miR-23a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-23a-3p
  • MICRORNA.ORG:hsa-miR-23a-3p
  • MIRDB:hsa-miR-23a-3p
  • RNA22-HSA:hsa-miR-23a-3p
  • TARGETMINER:hsa-miR-23a-3p
  • TARGETSCAN-VERT:hsa-miR-23a
  • PICTAR-VERT:hsa-miR-23a

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:12808467 "Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells" Kawasaki H, Taira K Nature. 423:838-842(2003).
4. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
7. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).