Stem-loop sequence hsa-mir-25

Accession MI0000082
Symbol HGNC:MIR25
Description Homo sapiens miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop 
    a ug   ag    g     uu g     u   --  ac 
ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
|||| |  |||  |||| |||||  | ||||| |||  ||  c
ccgg c  gac  ucug cucug  c cguua cgg  cc  u
    c gu   ag    g     uu a     -   gu  cg
Get sequence
Deep sequencing
230520 reads, 34 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 99691183-99691266 [-]
sense
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336732 ; MCM7-014; intron 2
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336601 ; MCM7-005; intron 4
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336600 ; MCM7-003; intron 8
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336598 ; MCM7-002; intron 12
OTTHUMT00000336602 ; MCM7-006; intron 12
OTTHUMT00000336534 ; MCM7-001; intron 13
OTTHUMT00000336534 ; MCM7-001; intron 13
OTTHUMT00000336534 ; MCM7-001; intron 13
ENST00000493352 ; MCM7-014; intron 2
ENST00000493352 ; MCM7-014; intron 2
ENST00000493352 ; MCM7-014; intron 2
ENST00000491245 ; MCM7-005; intron 4
ENST00000491245 ; MCM7-005; intron 4
ENST00000491245 ; MCM7-005; intron 4
ENST00000343023 ; MCM7-003; intron 8
ENST00000343023 ; MCM7-003; intron 8
ENST00000343023 ; MCM7-003; intron 8
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000542483 ; MCM7-203; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000542483 ; MCM7-203; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000489841 ; MCM7-002; intron 12
ENST00000485286 ; MCM7-006; intron 12
ENST00000354230 ; MCM7-201; intron 12
ENST00000303887 ; MCM7-001; intron 13
ENST00000303887 ; MCM7-001; intron 13
ENST00000303887 ; MCM7-001; intron 13
ENST00000362082 ; MCM7-202; intron 14
ENST00000362082 ; MCM7-202; intron 14
Clustered miRNAs
< 10kb from hsa-mir-25
hsa-mir-106b chr7: 99691616-99691697 [-]
hsa-mir-93 chr7: 99691391-99691470 [-]
hsa-mir-25 chr7: 99691183-99691266 [-]
Database links

Mature sequence hsa-miR-25-5p

Accession MIMAT0004498
Previous IDs hsa-miR-25*
Sequence

14 -  

aggcggagacuugggcaauug

 - 34

Get sequence
Deep sequencing 24130 reads, 28 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-25-3p

Accession MIMAT0000081
Previous IDs hsa-miR-25
Sequence

52 -  

cauugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing 206390 reads, 33 experiments
Evidence experimental; cloned [1-4], Northern [1]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).