|
miRBase |
|
Stem-loop sequence hsa-mir-25 |
||||||||
| Accession | MI0000082 | |||||||
| Symbol | HGNC:MIR25 | |||||||
| Description | Homo sapiens miR-25 stem-loop | |||||||
| Gene family | MIPF0000013; mir-25 | |||||||
| Stem-loop |
a ug ag g uu g u -- ac ggcc g uug aggc gagac g gcaau gcu gg g |||| | ||| |||| ||||| | ||||| ||| || c ccgg c gac ucug cucug c cguua cgg cc u c gu ag g uu a - gu cg |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
Mature sequence hsa-miR-25-5p |
|
| Accession | MIMAT0004498 |
| Previous IDs | hsa-miR-25* |
| Sequence |
14 - aggcggagacuugggcaauug - 34 |
| Deep sequencing | 24130 reads, 28 experiments |
| Evidence | experimental; cloned [3] |
| Predicted targets |
|
Mature sequence hsa-miR-25-3p |
|
| Accession | MIMAT0000081 |
| Previous IDs | hsa-miR-25 |
| Sequence |
52 - cauugcacuugucucggucuga - 73 |
| Deep sequencing | 206390 reads, 33 experiments |
| Evidence | experimental; cloned [1-4], Northern [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
| 2 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|