Stem-loop sequence hsa-mir-27a

AccessionMI0000085 (change log)
Previous IDshsa-mir-27
Symbol HGNC:MIR27A
DescriptionHomo sapiens miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

380 open access papers mention hsa-mir-27a
(2263 sentences)

Stem-loop
      a  a  a         ug  u       g  u cac 
5' cug gg gc gggcuuagc  cu gugagca gg c   a
   ||| || || |||||||||  || ||||||| || |    
3' gac cc cg cuugaaucg  ga cacuugu cu g   c
      c  c  c         gu  -       g  - aac 
Get sequence
Deep sequencing
3554414 reads, 8.59e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was previously named miR-27 [1,2] but is renamed here to avoid confusion with the more recently described miR-27b (MI0000440).

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 13836440-13836517 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-27a
hsa-mir-23achr19: 13836587-13836659 [-]
hsa-mir-27achr19: 13836440-13836517 [-]
hsa-mir-24-2chr19: 13836287-13836359 [-]
Database links

Mature sequence hsa-miR-27a-5p

Accession MIMAT0004501
Previous IDshsa-miR-27a*
Sequence

10 - 

agggcuuagcugcuugugagca

 - 31

Get sequence
Deep sequencing6268 reads, 131 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

Mature sequence hsa-miR-27a-3p

Accession MIMAT0000084
Previous IDshsa-miR-27a
Sequence

51 - 

uucacaguggcuaaguuccgc

 - 71

Get sequence
Deep sequencing3548112 reads, 159 experiments
Evidence experimental; cloned [1,3-5], Northern [1]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).