|
miRBase |
|
Stem-loop sequence hsa-mir-30a |
|||||
| Accession | MI0000088 | ||||
| Previous IDs | hsa-mir-30 | ||||
| Symbol | HGNC:MIR30A | ||||
| Description | Homo sapiens miR-30a stem-loop | ||||
| Gene family | MIPF0000005; mir-30 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells. |
||||
| Stem-loop |
a uc ----- a gcg cuguaaacaucc gacuggaagcu gug a ||| |||||||||||| ||||||||||| ||| cgu gacguuuguagg cugacuuucgg cac g c -- guaga c |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequences miR-30 [1] and miR-97 [2] appear to originate from the same precursor. Subsequent data confirm that both arms of the precursor appear to give rise to mature miRNA sequences (Pfeffer S, pers. comm.). Landgraf et al. later showed that the 5' product is the predominant one [5]. Related miRNAs are processed from the 5' arms of other precursor loci (mir-30b, MI0000441 ; mir-30c-1, MI0000736 ; mir-30c-2, MI0000254 ; mir-30d, MI0000255 ; mir-30e, MI0000749). |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-30a-5p |
|
| Accession | MIMAT0000087 |
| Previous IDs | hsa-miR-30a-5p;hsa-miR-30a |
| Sequence |
6 - uguaaacauccucgacuggaag - 27 |
| Deep sequencing | 154393 reads, 32 experiments |
| Evidence | experimental; cloned [2,4-6] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-30a-3p |
|
| Accession | MIMAT0000088 |
| Previous IDs | hsa-miR-30a-3p;hsa-miR-30a* |
| Sequence |
47 - cuuucagucggauguuugcagc - 68 |
| Deep sequencing | 42055 reads, 36 experiments |
| Evidence | experimental; cloned [1,4-5], Northern [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
| 2 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
| 3 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
| 4 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
| 5 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 6 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|