Stem-loop sequence hsa-mir-92a-1

Accession

MI0000093 (change log)

Previous IDs

hsa-mir-92-13;hsa-mir-92-1

Symbol

HGNC:MIR92A1

Description

Homo sapiens miR-92a-1 stem-loop

Gene family

MIPF0000013; mir-25

Literature search

361 open access papers mention hsa-mir-92a-1
(1539 sentences)

Stem-loop

   ---cu   uac            c   u           uu 
5'      uuc   acagguugggau ggu gcaaugcugug  u
        |||   |||||||||||| ||| |||||||||||   
3'      gag   uguccggcccug uca cguuaugguau  c
   gguuu   --u            u   -           gu 

Deep sequencing

2873011 reads, 8.6e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MI0000719 and MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr13: 91351314-91351391 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-92a-1

• hsa-mir-17: chr13: 91350605-91350688 [+]
• hsa-mir-18a: chr13: 91350751-91350821 [+]
• hsa-mir-19a: chr13: 91350891-91350972 [+]
• hsa-mir-20a: chr13: 91351065-91351135 [+]
• hsa-mir-19b-1: chr13: 91351192-91351278 [+]
• hsa-mir-92a-1: chr13: 91351314-91351391 [+]

Database links

• EntrezGene:MIR92A1
• HGNC:MIR92A1
• RNAcentral:URS00002B6637_9606
• miRBase Tracker:MI0000093

Mature sequence hsa-miR-92a-1-5p

• Accession: MIMAT0004507
• Previous IDs: hsa-miR-92a-1*
• Sequence: 11 - agguugggaucgguugcaaugcu - 33
• Deep sequencing: 32538 reads, 135 experiments
• Evidence: experimental; cloned [7-8]
• Database links:
  • RNAcentral:URS00001DA458_9606
• Predicted targets:
  • TargetMiner:hsa-miR-92a-1-5p
  • TargetScanVert:hsa-miR-92a-1-5p
  • miRDB:hsa-miR-92a-1-5p
  • microrna.org:hsa-miR-92a-1-5p

Mature sequence hsa-miR-92a-3p

• Accession: MIMAT0000092
• Previous IDs: hsa-miR-92;hsa-miR-92a
• Sequence: 48 - uauugcacuugucccggccugu - 69
• Deep sequencing: 5313749 reads, 159 experiments
• Evidence: experimental; cloned [1,3,5-8], Northern [4]
• Database links:
  • RNAcentral:URS00003768C5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-92a-3p
  • TargetScanVert:hsa-miR-92a-3p
  • miRDB:hsa-miR-92a-3p
  • microrna.org:hsa-miR-92a-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
5. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).