![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-92a-1 |
||||||||||||||
Accession | MI0000093 (change log) | |||||||||||||
Previous IDs | hsa-mir-92-13;hsa-mir-92-1 | |||||||||||||
Symbol | HGNC:MIR92A1 | |||||||||||||
Description | Homo sapiens miR-92a-1 stem-loop | |||||||||||||
Gene family | MIPF0000013; mir-25 | |||||||||||||
Literature search |
![]()
361 open access papers mention hsa-mir-92a-1 | |||||||||||||
Stem-loop |
---cu uac c u uu 5' uuc acagguugggau ggu gcaaugcugug u ||| |||||||||||| ||| ||||||||||| 3' gag uguccggcccug uca cguuaugguau c gguuu --u u - gu |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
Human miR-92a (previously named miR-92 here) has two predicted hairpin precursor sequences: mir-92a-1 (MI0000093) on chromosome 13 (named mir-92-13 in [1]) and mir-92a-2 (MI0000094) on chromosome X (named mir-92-X in [1]). miR-92a has also been cloned from mouse embryonic stem cells [2] and is predicted to be expressed from two closely related precursor hairpins (MI0000719 and MI0000580). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [7]. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence hsa-miR-92a-1-5p |
|
Accession | MIMAT0004507 |
Previous IDs | hsa-miR-92a-1* |
Sequence |
11 - agguugggaucgguugcaaugcu - 33 |
Deep sequencing | 32538 reads, 135 experiments |
Evidence | experimental; cloned [7-8] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-92a-3p |
|
Accession | MIMAT0000092 |
Previous IDs | hsa-miR-92;hsa-miR-92a |
Sequence |
48 - uauugcacuugucccggccugu - 69 |
Deep sequencing | 5313749 reads, 159 experiments |
Evidence | experimental; cloned [1,3,5-8], Northern [4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
4 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
5 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
6 |
PMID:15978578
"Identification of human fetal liver miRNAs by a novel method"
FEBS Lett. 579:3849-3854(2005).
|
7 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
8 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|