![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-95 |
|||||
Accession | MI0000097 (change log) | ||||
Previous IDs | hsa-mir-95-4 | ||||
Symbol | HGNC:MIR95 | ||||
Description | Homo sapiens miR-95 stem-loop | ||||
Gene family | MIPF0000098; mir-95 | ||||
Literature search |
![]()
36 open access papers mention hsa-mir-95 | ||||
Stem-loop |
a c ca gu - aa 5' aca aguggg cucaauaaau cuguugaau uga u ||| |||||| |||||||||| ||||||||| ||| 3' ugu ucaccc gaguuauuua ggcaacuua auu g g c ac ug c gc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is localised to chromosome 4 and was named mir-95-4 in reference [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-95-5p |
|
Accession | MIMAT0026473 |
Sequence |
15 - ucaauaaaugucuguugaauu - 35 |
Deep sequencing | 277 reads, 77 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-95-3p |
|
Accession | MIMAT0000094 |
Sequence |
49 - uucaacggguauuuauugagca - 70 |
Deep sequencing | 39905 reads, 151 experiments |
Evidence | experimental; cloned [1-2], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|