Stem-loop sequence hsa-mir-95

Accession

MI0000097 (change log)

Previous IDs

hsa-mir-95-4

Symbol

HGNC:MIR95

Description

Homo sapiens miR-95 stem-loop

Gene family

MIPF0000098; mir-95

Literature search

36 open access papers mention hsa-mir-95
(110 sentences)

Stem-loop

   a   c      ca          gu         -   aa 
5'  aca aguggg  cucaauaaau  cuguugaau uga  u
    ||| ||||||  ||||||||||  ||||||||| |||   
3'  ugu ucaccc  gaguuauuua  ggcaacuua auu  g
   g   c      ac          ug         c   gc 

Deep sequencing

40192 reads, 164 reads per million, 156 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is localised to chromosome 4 and was named mir-95-4 in reference [1].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr4: 8005301-8005381 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000127607 ; ABLIM2-012; intron 4

  OTTHUMT00000127606 ; ABLIM2-005; intron 10

  OTTHUMT00000358860 ; ABLIM2-001; intron 13

  OTTHUMT00000358886 ; ABLIM2-006; intron 13

  OTTHUMT00000363009 ; ABLIM2-003; intron 14

  OTTHUMT00000358862 ; ABLIM2-002; intron 15

  OTTHUMT00000358884 ; ABLIM2-004; intron 15

  OTTHUMT00000363013 ; ABLIM2-016; intron 16

  ENST00000512594 ; ABLIM2-012; intron 4

  ENST00000514025 ; ABLIM2-005; intron 10

  ENST00000407564 ; ABLIM2-001; intron 13

  ENST00000505872 ; ABLIM2-006; intron 13

  ENST00000361737 ; ABLIM2-003; intron 14

  ENST00000546334 ; ABLIM2-204; intron 14

  ENST00000341937 ; ABLIM2-002; intron 15

  ENST00000361581 ; ABLIM2-004; intron 15

  ENST00000545242 ; ABLIM2-203; intron 15

  ENST00000318888 ; ABLIM2-202; intron 15

  ENST00000447017 ; ABLIM2-016; intron 16

  ENST00000296372 ; ABLIM2-201; intron 16

Database links

• EntrezGene:MIR95
• HGNC:MIR95
• RNAcentral:URS000015F70F_9606
• miRBase Tracker:MI0000097

Mature sequence hsa-miR-95-5p

• Accession: MIMAT0026473
• Sequence: 15 - ucaauaaaugucuguugaauu - 35
• Deep sequencing: 277 reads, 77 experiments
• Evidence: experimental; Illumina [3]
• Database links:
  • RNAcentral:URS000075D912_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-95-5p
  • miRDB:hsa-miR-95-5p

Mature sequence hsa-miR-95-3p

• Accession: MIMAT0000094
• Sequence: 49 - uucaacggguauuuauugagca - 70
• Deep sequencing: 39905 reads, 151 experiments
• Evidence: experimental; cloned [1-2], Illumina [3]
• Database links:
  • RNAcentral:URS00002E2DE7_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-95-3p
  • miRDB:hsa-miR-95-3p
  • microrna.org:hsa-miR-95-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).