WARNING: This summary was generated by AI. MIR95 is a microRNA (miRNA) that has been identified as having an oncogenic function, with high expression levels in prostate and lung cancers [PMC5302951]. It is also differentially expressed in patients with primary myelofibrosis and has been associated with immune tolerance in liver transplant recipients, suggesting a role in immune regulation [PMC6183594; PMC7412931].. In regulatory T cells (Tregs), MIR95 is upregulated, indicating its potential involvement in Treg function [PMC7154970]. MIR95 has been identified as a candidate biomarker for liver transplant tolerance, highlighting its potential clinical relevance [PMC8376267]. It also appears to play a role in myogenic differentiation and may act as a disease modifier in facioscapulohumeral muscular dystrophy (FSHD) due to its interaction with specific binding sites that can be disrupted by genetic variants [PMC6969370]. In skeletal muscle, MIR95 expression levels are associated with muscle mass regulation [PMC6812755]. Additionally, MIR95 has been implicated in the modulation of apoptosis and radioresistance of cancer cells, suggesting its involvement in cancer cell survival mechanisms [PMC6525830; PMC3849454].. Research on the genomic organization and sequence conservation of MIR95 suggests that it may interact with numerous target mRNAs, further indicating its biological significance across different cellular processes [PMC3874173].
a c ca - aa aca aguggg cUCAAUAAAUGUCUGUUGAAU Uga u ||| |||||| ||||||||||||||||||||| ||| ugu ucaccc GAGUUAUUUAUGGGCAACUUa auu g g c AC c gc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000094 |
| Description | Homo sapiens hsa-miR-95-3p mature miRNA |
| Sequence | 49 - UUCAACGGGUAUUUAUUGAGCA - 70 |
| Evidence |
experimental
cloned [1-2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026473 |
| Description | Homo sapiens hsa-miR-95-5p mature miRNA |
| Sequence | 15 - UCAAUAAAUGUCUGUUGAAUU - 35 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|