Stem-loop sequence hsa-mir-101-1

Accession

MI0000103

Previous IDs

hsa-mir-101-1;hsa-mir-101

Symbol

HGNC:MIR101-1

Description

Homo sapiens miR-101-1 stem-loop

Gene family

MIPF0000046; mir-101

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-101_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-101 microRNA precursor is a small non-coding RNA that regulates gene expression. Expression of miR-101 has been validated in both human (MI0000103, MI0000739) and mouse (MI0000148). This microRNA appears to be specific to the vertebrates and has now been predicted or confirmed in a wide range of vertebrate species (MIPF0000046). The precursor microRNA is a stem-loop structure of about 70 nucleotides in length that is processed by the Dicer enzyme to form the 21-24 nucleotide mature microRNA. In this case the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

u   cuggc                  a    gucua 
 gcc     ucaguuaucacagugcug ugcu     u
 |||     |||||||||||||||||| ||||      
 cgg     agucaauagugucaugac augg     u
a   uagga                  -    aaauc 

Deep sequencing

54166 reads, 45 experiments

Comments

Reference [1] reports two miR-101 precursor hairpin structures in human, on chromosome 1 (MI0000103 ) and 9 (MI0000739 , named mir-101-precursor-9 in [1]). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh37.p5): chr1: 65524117-65524191 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-101-1

• hsa-mir-101-1: chr1: 65524117-65524191 [-]
• hsa-mir-3671: chr1: 65523438-65523525 [-]

Database links

• EMBL: AF480499;AF480499
• EMBL: AF480539;AF480539
• ENTREZGENE: 406893;MIR101-1
• HGNC: 31488;MIR101-1

Mature sequence hsa-miR-101-5p

• Accession: MIMAT0004513
• Previous IDs: hsa-miR-101*
• Sequence: 11 - caguuaucacagugcugaugcu - 32
• Deep sequencing: 40 reads, 11 experiments
• Evidence: experimental; cloned [3-4]
• Validated targets:
  • TARBASE:hsa-miR-101-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-101-5p
  • MICRORNA.ORG:hsa-miR-101-5p
  • MIRDB:hsa-miR-101-5p
  • RNA22-HSA:hsa-miR-101-5p
  • TARGETMINER:hsa-miR-101-5p
  • PICTAR-VERT:hsa-miR-101

Mature sequence hsa-miR-101-3p

• Accession: MIMAT0000099
• Previous IDs: hsa-miR-101
• Sequence: 47 - uacaguacugugauaacugaa - 67
• Deep sequencing: 108293 reads, 46 experiments
• Evidence: experimental; cloned [1-4]
• Validated targets:
  • TARBASE:hsa-miR-101-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-101-3p
  • MICRORNA.ORG:hsa-miR-101-3p
  • MIRDB:hsa-miR-101-3p
  • RNA22-HSA:hsa-miR-101-3p
  • TARGETMINER:hsa-miR-101-3p
  • TARGETSCAN-VERT:hsa-miR-101
  • PICTAR-VERT:hsa-miR-101

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).