Stem-loop sequence hsa-mir-29b-1

AccessionMI0000105 (change log)
Previous IDshsa-mir-102-7.1;hsa-mir-102-2;hsa-mir-29b-2
Symbol HGNC:MIR29B1
DescriptionHomo sapiens miR-29b-1 stem-loop
Gene family MIPF0000009; mir-29
Literature search

661 open access papers mention hsa-mir-29b-1
(4305 sentences)

Stem-loop
   -         -          u      gu      uuaaa 
5'  cuucaggaa gcugguuuca auggug  uuagau     u
    ||||||||| |||||||||| ||||||  ||||||     a
3'  gggguucuu ugacuaaagu uaccac  gaucug     g
   g         g          u      --      uuagu 
Get sequence
Deep sequencing
3094895 reads, 8.56e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-102-7.1 and mir-102-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-102 locus on chromosome 7. Human miR-102 is a homologue of mouse miR-29b (MI0000143) and so has been renamed here for consistency.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 130877459-130877539 [-]
antisense
OTTHUMT00000338094 ; MKLN1-012; intron 2
OTTHUMT00000338095 ; MKLN1-013; intron 2
ENST00000421797 ; MKLN1-012; intron 2
ENST00000416992 ; MKLN1-013; intron 2
Clustered miRNAs
< 10kb from hsa-mir-29b-1
hsa-mir-29b-1chr7: 130877459-130877539 [-]
hsa-mir-29achr7: 130876747-130876810 [-]
Database links

Mature sequence hsa-miR-29b-1-5p

Accession MIMAT0004514
Previous IDshsa-miR-29b-1*
Sequence

10 - 

gcugguuucauauggugguuuaga

 - 33

Get sequence
Deep sequencing6539 reads, 153 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-29b-3p

Accession MIMAT0000100
Previous IDshsa-miR-29b
Sequence

51 - 

uagcaccauuugaaaucaguguu

 - 73

Get sequence
Deep sequencing6175636 reads, 159 experiments
Evidence experimental; cloned [1-4], Northern [2]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).