![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-29b-2 |
||||||
Accession | MI0000107 (change log) | |||||
Previous IDs | hsa-mir-102-1;hsa-mir-29b-1 | |||||
Symbol | HGNC:MIR29B2 | |||||
Description | Homo sapiens miR-29b-2 stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Literature search |
![]()
652 open access papers mention hsa-mir-29b-2 | |||||
Stem-loop |
- c g u uuuucc 5' cuucuggaa gcugguuuca auggug cu agau a ||||||||| |||||||||| |||||| || |||| 3' gaggauuuu ugacuaaagu uaccac ga ucua u g u - - uguuuc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MI0000143) and so has been renamed here for consistency. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-29b-2-5p |
|
Accession | MIMAT0004515 |
Previous IDs | hsa-miR-29b-2* |
Sequence |
11 - cugguuucacaugguggcuuag - 32 |
Deep sequencing | 20660 reads, 152 experiments |
Evidence | experimental; cloned [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-29b-3p |
|
Accession | MIMAT0000100 |
Previous IDs | hsa-miR-29b |
Sequence |
52 - uagcaccauuugaaaucaguguu - 74 |
Deep sequencing | 6175636 reads, 159 experiments |
Evidence | experimental; cloned [1-4], Northern [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|