Stem-loop sequence hsa-mir-29b-2

Accession

MI0000107 (change log)

Previous IDs

hsa-mir-102-1;hsa-mir-29b-1

Symbol

HGNC:MIR29B2

Description

Homo sapiens miR-29b-2 stem-loop

Gene family

MIPF0000009; mir-29

Literature search

652 open access papers mention hsa-mir-29b-2
(4257 sentences)

Stem-loop

            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 

Deep sequencing

3108179 reads, 8.56e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MI0000143) and so has been renamed here for consistency.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 207802443-207802523 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000382528 ; CR1-011; intron 13

  OTTHUMT00000382524 ; CR1-007; intron 37

  OTTHUMT00000088499 ; CR1-002; intron 37

  OTTHUMT00000088500 ; CR1-003; intron 37

  OTTHUMT00000088335 ; CR1-001; intron 37

  OTTHUMT00000382527 ; CR1-012; intron 45

  ENST00000529814 ; CR1-011; intron 13

  ENST00000367052 ; CR1-007; intron 37

  ENST00000367051 ; CR1-002; intron 37

  ENST00000367053 ; CR1-003; intron 37

  ENST00000400960 ; CR1-001; intron 37

  ENST00000367049 ; CR1-012; intron 45

Clustered miRNAs

< 10kb from hsa-mir-29b-2

• hsa-mir-29b-2: chr1: 207802443-207802523 [-]
• hsa-mir-29c: chr1: 207801852-207801939 [-]

Database links

• EntrezGene:MIR29B2
• HGNC:MIR29B2
• RNAcentral:URS00001E96DA_9606
• Rfam:mir-29
• miRBase Tracker:MI0000107

Mature sequence hsa-miR-29b-2-5p

• Accession: MIMAT0004515
• Previous IDs: hsa-miR-29b-2*
• Sequence: 11 - cugguuucacaugguggcuuag - 32
• Deep sequencing: 20660 reads, 152 experiments
• Evidence: experimental; cloned [3]
• Database links:
  • RNAcentral:URS0000403C02_9606
• Predicted targets:
  • TargetMiner:hsa-miR-29b-2-5p
  • TargetScanVert:hsa-miR-29b-2-5p
  • miRDB:hsa-miR-29b-2-5p
  • microrna.org:hsa-miR-29b-2-5p

Mature sequence hsa-miR-29b-3p

• Accession: MIMAT0000100
• Previous IDs: hsa-miR-29b
• Sequence: 52 - uagcaccauuugaaaucaguguu - 74
• Deep sequencing: 6175636 reads, 159 experiments
• Evidence: experimental; cloned [1-4], Northern [2]
• Database links:
  • RNAcentral:URS000024463E_9606
• Predicted targets:
  • TargetMiner:hsa-miR-29b-3p
  • TargetScanVert:hsa-miR-29b-3p
  • miRDB:hsa-miR-29b-3p
  • microrna.org:hsa-miR-29b-3p

References

1. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).