![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-107 |
|||||
Accession | MI0000114 (change log) | ||||
Previous IDs | hsa-mir-107-10 | ||||
Symbol | HGNC:MIR107 | ||||
Description | Homo sapiens miR-107 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
185 open access papers mention hsa-mir-107 | ||||
Stem-loop |
c c --c u u c u a 5' ucu ugcuuu agcu cu uacaguguugc uug ggc u ||| |||||| |||| || ||||||||||| ||| ||| g 3' aga acgaaa ucgg ga auguuacgacg aac uug g - c cua - c - - a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-107 |
|
Accession | MIMAT0000104 |
Sequence |
50 - agcagcauuguacagggcuauca - 72 |
Deep sequencing | 5488993 reads, 159 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|