Stem-loop sequence hsa-mir-107

AccessionMI0000114 (change log)
Previous IDshsa-mir-107-10
Symbol HGNC:MIR107
DescriptionHomo sapiens miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

185 open access papers mention hsa-mir-107
(934 sentences)

Stem-loop 
   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a
Get sequence
Deep sequencing
5491348 reads, 1.19e+04 reads per million, 162 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified by homology to miR-103 [1], and later verified by cloning in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 89592747-89592827 [-]
sense
OTTHUMT00000049238 ; ATAD1-004; intron 1
ENST00000495903 ; ATAD1-004; intron 1
ENST00000495193 ; RN7SL78P-201; exon 1
antisense
OTTHUMT00000091432 ; CFLP1-002; intron 3
ENST00000438248 ; CFL1P1-002; intron 3
Database links

Mature sequence hsa-miR-107

Accession MIMAT0000104
Sequence

50 -  

agcagcauuguacagggcuauca

 - 72

Get sequence
Deep sequencing5488993 reads, 159 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).