![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-16-2 |
||||||
Accession | MI0000115 (change log) | |||||
Previous IDs | hsa-mir-16-3 | |||||
Symbol | HGNC:MIR16-2 | |||||
Description | Homo sapiens miR-16-2 stem-loop | |||||
Gene family | MIPF0000006; mir-15 | |||||
Literature search |
![]()
682 open access papers mention hsa-mir-16-2 | |||||
Stem-loop |
uc cu ua c ag aau 5' gu cacu agcagcacg aauauugg gu uga a || |||| ||||||||| |||||||| || ||| 3' ca guga ucgucgugu uuauaacc ca auu u gu uu ca a -a aua |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MI0000070). The sequence was previously named mir-16-3 here and in references [1] and [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-16-5p |
|
Accession | MIMAT0000069 |
Previous IDs | hsa-miR-16 |
Sequence |
10 - uagcagcacguaaauauuggcg - 31 |
Deep sequencing | 7830515 reads, 159 experiments |
Evidence | experimental; cloned [1,3-4,6-8], Northern [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-16-2-3p |
|
Accession | MIMAT0004518 |
Previous IDs | hsa-miR-16-2* |
Sequence |
53 - ccaauauuacugugcugcuuua - 74 |
Deep sequencing | 12590 reads, 157 experiments |
Evidence | experimental; cloned [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11914277
"miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs"
Genes Dev. 16:720-728(2002).
|
2 |
PMID:12624257
"Vertebrate microRNA genes"
Science. 299:1540(2003).
|
3 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
4 |
PMID:15183728
"Human embryonic stem cells express a unique set of microRNAs"
Dev Biol. 270:488-498(2004).
|
5 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
6 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
7 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
8 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|