Stem-loop sequence dme-mir-1

Accession

MI0000116 (change log)

Description

Drosophila melanogaster miR-1 stem-loop

Gene family

MIPF0000038; mir-1

Literature search

46 open access papers mention dme-mir-1
(226 sentences)

Stem-loop

   uuca   uuu  --ga            c        a   -   au 
5'     gcc   ga    guuccaugcuuc uugcauuc aua guu  a
       |||   ||    |||||||||||| |||||||| ||| |||  u
3'     cgg   cu    cgagguaugaag aauguaag uau cga  u
   -gag   --u  aaag            a        g   a   ac 

Deep sequencing

21971570 reads, 1.14e+05 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr2L: 20487441-20487531 [+]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS000025C956_7227
• Rfam:mir-1
• miRBase Tracker:MI0000116

Mature sequence dme-miR-1-5p

• Accession: MIMAT0020779
• Sequence: 18 - ccaugcuuccuugcauucaaua - 39
• Deep sequencing: 3878 reads, 31 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00003152B4_7227

Mature sequence dme-miR-1-3p

• Accession: MIMAT0000105
• Previous IDs: dme-miR-1
• Sequence: 56 - uggaauguaaagaaguauggag - 77
• Deep sequencing: 21967687 reads, 49 experiments
• Evidence: experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00005942EF_7227
• Predicted targets:
  • TargetScanFly:dme-miR-1
  • microrna.org:dme-miR-1-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).