![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence dme-mir-1 |
|||||
Accession | MI0000116 (change log) | ||||
Description | Drosophila melanogaster miR-1 stem-loop | ||||
Gene family | MIPF0000038; mir-1 | ||||
Literature search |
![]()
46 open access papers mention dme-mir-1 | ||||
Stem-loop |
uuca uuu --ga c a - au 5' gcc ga guuccaugcuuc uugcauuc aua guu a ||| || |||||||||||| |||||||| ||| ||| u 3' cgg cu cgagguaugaag aauguaag uau cga u -gag --u aaag a g a ac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence dme-miR-1-5p |
|
Accession | MIMAT0020779 |
Sequence |
18 - ccaugcuuccuugcauucaaua - 39 |
Deep sequencing | 3878 reads, 31 experiments |
Evidence | not experimental |
Database links |
|
Mature sequence dme-miR-1-3p |
|
Accession | MIMAT0000105 |
Previous IDs | dme-miR-1 |
Sequence |
56 - uggaauguaaagaaguauggag - 77 |
Deep sequencing | 21967687 reads, 49 experiments |
Evidence | experimental; cloned [1,3], Northern [1-2], 454 [4-5], Illumina [5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:11679670
"Identification of novel genes coding for small expressed RNAs"
Science. 294:853-858(2001).
|
2 | |
3 |
PMID:12919683
"The small RNA profile during Drosophila melanogaster development"
Dev Cell. 5:337-350(2003).
|
4 |
PMID:17989254
"Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
Genome Res. 17:1850-1864(2007).
|
5 |
PMID:17989255
"Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"
Genome Res. 17:1865-1879(2007).
|