miRBase entry: dme-mir-2b-1

Stem-loop dme-mir-2b-1


Accession
MI0000119
Description
Drosophila melanogaster dme-mir-2b-1 precursor miRNA
Gene family
MIPF0000049; mir-2

Literature search
28 open access papers mention dme-mir-2b-1
(119 sentences)

Sequence

476886 reads, 9716 reads per million, 49 experiments
cuucaacuGUCUUCAAAGUGGCAGUGACAUGuugucaacaauauucaUAUCACAGCCAGCUUUGAGGAGCguugcgg
((.((((..(((((((((((((.((((.((((((....)))))).....)))).)))).)))))))))..)))).))

Structure
  u    uG         -    A    ----C      u 
cu caac  UCUUCAAAG UGGC GUGA     AUGuug c
|| ||||  ||||||||| |||| ||||     ||||||  
gg guug  AGGAGUUUC ACCG CACU     uauaac a
  c    CG         G    A    AUacu      a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Stark et al. [2] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
chr2L: 8258616-8258692 [-]

Database links

Mature dme-miR-2b-3p

Accession MIMAT0000107
Description Drosophila melanogaster dme-miR-2b-3p mature miRNA
Sequence 48 - UAUCACAGCCAGCUUUGAGGAGC - 70
Evidence experimental
cloned [1,4], Northern [1,3], 454 [5-6], Illumina [6]
Database links
Predicted targets

Mature dme-miR-2b-1-5p

Accession MIMAT0020782
Description Drosophila melanogaster dme-miR-2b-1-5p mature miRNA
Sequence 9 - GUCUUCAAAGUGGCAGUGACAUG - 31
Evidence not_experimental
Database links

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  3. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  4. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  5. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  6. PubMed ID: 14691535
    Identification of Drosophila MicroRNA targets
    "Stark A, Brennecke J, Russell RB, Cohen SM"
    "PLoS Biol (2003) 1:E60