Stem-loop sequence dme-mir-10

Accession

MI0000130 (change log)

Description

Drosophila melanogaster miR-10 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

19 open access papers mention dme-mir-10
(147 sentences)

Stem-loop

        ucu   -  g    u             auacu 
5' ccacg   acc cu uaga ccgaauuuguuuu     a
   |||||   ||| || |||| |||||||||||||      
3' ggugu   ugg ga aucu ggcuuaaacagga     g
        guu   a  g    u             auuuc 

Deep sequencing

879179 reads, 6.03e+03 reads per million, 49 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The first cloning experiments identified the mature miR-10 from the 5' arm of the D. melanogaster precursor [1,3]. High-throughput sequencing later showed that the sequence from the 3' arm dominates [4-5].

Genome context

• Coordinates (Release_6; GCA_000001215.4): chr3R: 6809506-6809582 [-]
• Overlapping transcripts:

  intergenic

Database links

• RNAcentral:URS0000038E51_7227
• Rfam:mir-10
• miRBase Tracker:MI0000130

Mature sequence dme-miR-10-5p

• Accession: MIMAT0000115
• Previous IDs: dme-miR-10;dme-miR-10*
• Sequence: 9 - acccuguagauccgaauuuguu - 30
• Deep sequencing: 440197 reads, 48 experiments
• Evidence: experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS0000470340_7227
• Predicted targets:
  • microrna.org:dme-miR-10-5p

Mature sequence dme-miR-10-3p

• Accession: MIMAT0012531
• Previous IDs: dme-miR-10
• Sequence: 49 - caaauucgguucuagagagguuu - 71
• Deep sequencing: 438977 reads, 48 experiments
• Evidence: experimental; cloned [1,3], Northern [1-3], 454 [4-5], Illumina [5]
• Database links:
  • RNAcentral:URS00004D4199_7227
• Predicted targets:
  • microrna.org:dme-miR-10-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:12812784 "Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity" Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V Dev Biol. 259:9-18(2003).
3. PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4. PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5. PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).