|
miRBase |
|
Stem-loop sequence mmu-mir-23b |
||||||||||
| Accession | MI0000141 | |||||||||
| Symbol | MGI:Mir23b | |||||||||
| Description | Mus musculus miR-23b stem-loop | |||||||||
| Gene family | MIPF0000027; mir-23 | |||||||||
| Stem-loop |
c u -- - c gugacu gg ugc ugg guuccuggca ug ugauuu u || ||| ||| |||||||||| || |||||| cc acg acc uagggaccgu ac acuaaa g a c au u - auuaga |
|||||||||
| Deep sequencing |
| |||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links | ||||||||||
Mature sequence mmu-miR-23b-5p |
|
| Accession | MIMAT0016980 |
| Previous IDs | mmu-miR-23b* |
| Sequence |
9 - ggguuccuggcaugcugauuu - 29 |
| Deep sequencing | 15824 reads, 69 experiments |
| Evidence | experimental; Solexa [6] |
| Predicted targets |
|
Mature sequence mmu-miR-23b-3p |
|
| Accession | MIMAT0000125 |
| Previous IDs | mmu-miR-23b |
| Sequence |
46 - aucacauugccagggauuacc - 66 |
| Deep sequencing | 757959 reads, 82 experiments |
| Evidence | experimental; cloned [1,3-4], Solexa [5-6] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
| 2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
| 3 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|