Stem-loop sequence mmu-mir-99a

Accession

MI0000146

Symbol

MGI:Mir99a

Description

Mus musculus miR-99a stem-loop

Gene family

MIPF0000025; mir-99

Stem-loop

    a         uc   u      g  aag 
caua acccguaga  cga cuugug ug   u
|||| |||||||||  ||| |||||| ||    
gugu uggguaucu  gcu gaacgc gc   g
    c         uu   c      -  cag 

Deep sequencing

283581 reads, 97 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38): chr16: 77598936-77599000 [+]
• Overlapping transcripts:

  antisense

  ENSMUST00000114231 ; Gm11146-201; intron 1

Clustered miRNAs

< 10kb from mmu-mir-99a

• mmu-mir-99a: chr16: 77598936-77599000 [+]
• mmu-let-7c-1: chr16: 77599657-77599750 [+]

Database links

• EMBL:AJ459728
• ENTREZGENE: 387229;Mir99a
• MGI: 2676912;Mir99a

Mature sequence mmu-miR-99a-5p

• Accession: MIMAT0000131
• Previous IDs: mmu-miR-99a
• Sequence: 5 - aacccguagauccgaucuugug - 26
• Deep sequencing: 261230 reads, 82 experiments
• Evidence: experimental; cloned [1-3], Solexa [4-5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-99a-5p
  • MICRORNA.ORG:mmu-miR-99a-5p
  • MIRDB:mmu-miR-99a-5p
  • RNA22-MMU:mmu-miR-99a-5p
  • TARGETSCAN-VERT:mmu-miR-99a

Mature sequence mmu-miR-99a-3p

• Accession: MIMAT0016981
• Previous IDs: mmu-miR-99a*
• Sequence: 42 - caagcucguuucuaugggucu - 62
• Deep sequencing: 1442 reads, 51 experiments
• Evidence: experimental; Solexa [5]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-99a-3p
  • MIRDB:mmu-miR-99a-3p
  • RNA22-MMU:mmu-miR-99a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).