miRBase entry: mmu-mir-128-1

Stem-loop mmu-mir-128-1


Accession
MI0000155
Symbol
MGI: Mir128-1
Description
Mus musculus mmu-mir-128-1 precursor miRNA
Gene family
MIPF0000048; mir-128

Literature search
77 open access papers mention mmu-mir-128-1
(569 sentences)

Sequence

646066 reads, 1663 reads per million, 105 experiments
guuggauuCGGGGCCGUAGCACUGUCUGAgagguuuacauuucUCACAGUGAACCGGUCUCUUUuucagc
((((((...(((((((...((((((..(((((((....)))))))))))))...)))))))...))))))

Structure
      uuC       UAG      CU       u 
guugga   GGGGCCG   CACUGU  GAgaggu u
||||||   |||||||   ||||||  |||||||  
cgacuu   CUCUGGC   GUGACA  CUcuuua a
      UUU       CAA      --       c 


Annotation confidence High
Do you think this miRNA is real?
Comments
The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context
chr1: 128202361-128202430 [+]

Database links

Mature mmu-miR-128-1-5p

Accession MIMAT0016982
Description Mus musculus mmu-miR-128-1-5p mature miRNA
Sequence 9 - CGGGGCCGUAGCACUGUCUGA - 29
Evidence experimental
Illumina [5]
Database links
Predicted targets

Mature mmu-miR-128-3p

Accession MIMAT0000140
Description Mus musculus mmu-miR-128-3p mature miRNA
Sequence 44 - UCACAGUGAACCGGUCUCUUU - 64
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009