![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-133a-1 |
||||||||
Accession | MI0000159 (change log) | |||||||
Previous IDs | mmu-mir-133 | |||||||
Symbol | MGI:Mir133a-1 | |||||||
Description | Mus musculus miR-133a-1 stem-loop | |||||||
Gene family | MIPF0000029; mir-133 | |||||||
Literature search |
![]()
236 open access papers mention mmu-mir-133a-1 | |||||||
Stem-loop |
a aa u a gccuc 5' gcua agcuggu aa gg accaaauc u |||| ||||||| || || |||||||| 3' cgau ucgacca uu cc ugguuuag u g ac c c guaac |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-133a-5p |
|
Accession | MIMAT0003473 |
Previous IDs | mmu-miR-133a* |
Sequence |
7 - gcugguaaaauggaaccaaau - 27 |
Deep sequencing | 19809 reads, 47 experiments |
Evidence | experimental; MPSS [2], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-133a-3p |
|
Accession | MIMAT0000145 |
Previous IDs | mmu-miR-133a |
Sequence |
43 - uuugguccccuucaaccagcug - 64 |
Deep sequencing | 357949 reads, 76 experiments |
Evidence | experimental; cloned [1,3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|