Stem-loop sequence mmu-mir-133a-1

Accession

MI0000159 (change log)

Previous IDs

mmu-mir-133

Symbol

MGI:Mir133a-1

Description

Mus musculus miR-133a-1 stem-loop

Gene family

MIPF0000029; mir-133

Literature search

236 open access papers mention mmu-mir-133a-1
(1706 sentences)

Stem-loop

       a       aa  u  a        gccuc 
5' gcua agcuggu  aa gg accaaauc     u
   |||| |||||||  || || ||||||||      
3' cgau ucgacca  uu cc ugguuuag     u
       g       ac  c  c        guaac 

Deep sequencing

188845 reads, 1.74e+03 reads per million, 76 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This mature miRNA sequence was named miR-133 in reference [1], and renamed miR-133a on subsequent identification of a homologue differing at the terminal 3' position (MI0000821). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr18: 10782909-10782976 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000111849 ; RP24-66N1.1-001; intron 1

  ENSMUST00000179771 ; Gm21747-001; intron 1

  ENSMUST00000083465 ; Mir133a-1-201; exon 1

  antisense

  OTTMUST00000070818 ; Mib1-004; intron 5

  OTTMUST00000070815 ; Mib1-001; intron 12

  ENSMUST00000124288 ; Mib1-004; intron 5

  ENSMUST00000052838 ; Mib1-001; intron 12

  ENSMUST00000165555 ; Mib1-201; intron 13

Clustered miRNAs

< 10kb from mmu-mir-133a-1

• mmu-mir-1a-2: chr18: 10785481-10785552 [-]
• mmu-mir-1b: chr18: 10785446-10785567 [+]
• mmu-mir-133a-1: chr18: 10782909-10782976 [-]

Database links

• EntrezGene:Mir133a-1
• MGI:Mir133a-1
• RNAcentral:URS000075EEA8_10090
• miRBase Tracker:MI0000159

Mature sequence mmu-miR-133a-5p

• Accession: MIMAT0003473
• Previous IDs: mmu-miR-133a*
• Sequence: 7 - gcugguaaaauggaaccaaau - 27
• Deep sequencing: 19809 reads, 47 experiments
• Evidence: experimental; MPSS [2], Illumina [4-5]
• Database links:
  • RNAcentral:URS000030913C_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-133a-5p
  • miRDB:mmu-miR-133a-5p
  • microrna.org:mmu-miR-133a-5p

Mature sequence mmu-miR-133a-3p

• Accession: MIMAT0000145
• Previous IDs: mmu-miR-133a
• Sequence: 43 - uuugguccccuucaaccagcug - 64
• Deep sequencing: 357949 reads, 76 experiments
• Evidence: experimental; cloned [1,3], Illumina [4-5]
• Database links:
  • RNAcentral:URS00004C9052_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-133a-3p.2
  • miRDB:mmu-miR-133a-3p
  • microrna.org:mmu-miR-133a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).