![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-135a-1 |
|||||
Accession | MI0000161 (change log) | ||||
Previous IDs | mmu-mir-135;mmu-mir-135-1 | ||||
Symbol | MGI:Mir135a-1 | ||||
Description | Mus musculus miR-135a-1 stem-loop | ||||
Gene family | MIPF0000028; mir-135 | ||||
Literature search |
![]()
73 open access papers mention mmu-mir-135a-1 | ||||
Stem-loop |
agg u u uu uucua 5' ccucacugu c cuauggcuuu auuccuauguga u ||||||||| | |||||||||| |||||||||||| u 3' ggaguggca g ggugccgagg uagggauauacu g aua u c -u cgcuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-135a-5p |
|
Accession | MIMAT0000147 |
Previous IDs | mmu-miR-135a |
Sequence |
17 - uauggcuuuuuauuccuauguga - 39 |
Deep sequencing | 365449 reads, 76 experiments |
Evidence | experimental; cloned [1,3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-135a-1-3p |
|
Accession | MIMAT0004531 |
Previous IDs | mmu-miR-135a*;mmu-miR-135a-1* |
Sequence |
56 - uauagggauuggagccguggcg - 77 |
Deep sequencing | 3321 reads, 43 experiments |
Evidence | experimental; cloned [3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|